Review




Structured Review

Sangon Biotech negative control sequence
Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sequence/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-06
86/100 stars

Images



Similar Products

95
MedChemExpress sirna sequences
Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna sequences/product/MedChemExpress
Average 95 stars, based on 1 article reviews
sirna sequences - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

86
Sangon Biotech negative control sequence
Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sequence/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Gene Tools Inc negative control sequence
Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sequence/product/Gene Tools Inc
Average 86 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech negative control sirna sequence
Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sirna sequence/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
negative control sirna sequence - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Genechem negative control oligonucleotide sequences lv nc
Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control oligonucleotide sequences lv nc/product/Genechem
Average 86 stars, based on 1 article reviews
negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

94
Addgene inc negative control sequence
Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sequence/product/Addgene inc
Average 94 stars, based on 1 article reviews
negative control sequence - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
Thermo Fisher negative control sequence without 5’ overhangs
KEY RESOURCES TABLE
Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sequence without 5’ overhangs/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
negative control sequence without 5’ overhangs - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
KEY RESOURCES TABLE
Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control sirna targeting the sequence ttctccgaacgtgtcacgt/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Journal: Neuron

Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

doi: 10.1016/j.neuron.2025.05.023

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software